| This
page contains more detailed protocols and primer sequences from Dean, BALLARD, GLASS and BallarD (2003) showing that Wolbachia uninfected Drosophila
simulans retain greater amounts of
mitochondrial
DNA polymorphism than infected populations in east Africa. Genetics 16:
159-169.
Cytotype
distribution and abundance: Shown below are schematic and empirical results
of competitive PCR assays used in the paper above.
Bold lines indicate DNA strands, boxes indicate
primers, arrows indicate direction of elongation, + and – indicate whether the
primer anneals to the major or minor strand, respectively. Figures not drawn to scale.
Distinguishing
between siI,
siII, or siIII:
These primers amplify fragments of size 1287 bp, 825 bp, and 483 bp from
siIII, -II, or –I, respectively.
|
| Primer:
| Sequence
(5' to 3'): |
| 2746+
| TATTTATTGGAGTAAATTTAACAT
| | 3440-
| GTTGGAATTATATATGAATCAAA
| | 3442+
| TTCAGATTTTAATAATATTGAATAT
| | 3928-
| TAATAATCATCTAATTGGTGCT
|
MtDNA sequencing: Three
regions were amplified and sequenced with the primers 1128+ and 1815-, 3182A+
and 3929-, and 7780+ and 8475-. Primer
3182A+ has a two base pair mismatch to siIII, while 3182B+ has a two base
pair mismatch to siII.
The regions yielded sequence of 599 bp, 601 bp, and 576 bp in length and
included portions of the ND2, COI, COII, ATP8, ND5, and ND4 genes, the transfer
RNAs tRNAtrp, tRNAcys, tRNAtyr, tRNAlys,
tRNAasp, and tRNAhis, and four intervening spacer regions.
| Primer:
| Sequence
(5' to 3'): |
| 1128+
| TTACGAATTTGTTATTCTGC
| | 1815-
| CGTTTTCAACTATTCTTCTC
| | 3182A+
| TCACGCATTATTAATTTTAG |
| 3182B+
| TCATGCATTATTGATTTTAG |
| 3929-
| AATAATCATCTAATTGGTGC
| | 7780+
| ATAGCAAGAAGAAAAGCTAC
| | 8475-
| ATTCTTTTAGACAACATGGA
| Period DNA sequencing: We
gathered 1029 continuous bp of the per
locus. This region contains 1 complete
exon, 2 partial exons, and 2 introns. PCR reactions
were carried out with the external primers 3768+ and 4856-.
For sequencing, we used the external primers and two additional
internal primers, 4348+ and 4286-.
| Primer:
| Sequence
(5' to 3'): |
| 3768+
| ACCTTCGCCAGTCAGATCAC
| | 4286-
| CGTCTGACCCTTCTTCATTACC
| | 4348+
| AAGCCATACCGCTTCCTCAT
| | 4856-
| TTTAGCTGGTTGTAGCTGGG
| PCR precipitation/purification:
To purify PCR reactions and remove unincorporated primers, we employed
a simple salt precipitation method, modified from [Kreitman, M., 1991 Molecular techniques in taxonomy, pp. 357-367
in NATO ASI Series, edited by G. M.
Hewitt, A. W. B. Johnson and J. P. W. Young. Springer-Verlag, Berlin].
This is an inexpensive and efficient method in terms of both money and
time. We precipite in the same tubes that the PCR reactions were
performed in, thus the method is best used in a 96 well tray format.
We describe the method for a 50 μl reaction, but it is easily modified
for different volumes. 1.
From 50 μl PCR reaction, visualize 4 μl on a gel. 2.
To remaining 46 μl PCR reaction, add 23 μl of 7.5 M Ammonium
Acetate (CH3CO2NH4). 3.
Add 69 μl cold 100% ethanol. 4.
Replace caps and gently invert a few times to mix.
Be mindful that the caps remain
sealed during mixing. 5.
Spin at 4ºC, 2200g for 15 minutes. 6.
Remove caps, invert tray, spin at 100g for 1 minute. 7.
Add 200 μl 70% ethanol to wash the pellet (which you probably will
not see). 8.
Replace caps, spin at 4ºC, 2200g for 1 minute. 9.
Remove caps, invert tray, spin at 100g for 1 minute.
10. Resuspend
as desired (we usually resuspend in 25 μl, then use 1-4 μl for sequencing
reactions).
|